Om detta skola vi icke hava en åsikt…

Då kommentarsfältet på min blogg sedan midnatt lördag 24.00 är blockerat för mig och jag därför inte kan svara på eller moderera inkommande post lägger jag – tills problemet är löst – ut detta svar som en separat artikel. Tror någon att det finns ett samband?

Magnus, jag kan bara konstatera att det finns två helt olika åsikter här på bloggen om huruvida viruset existerar eller inte. Jag hävdar varken det ena eller det andra, eftersom jag inte har tillräcklig medicinsk kunskap att bedöma frågan.
Hela vaccinationskampanjen bygger däremot på förekomsten av ett virus som gör oss svårt sjuka eller får oss att dö. Detta för att vi skall fås att tro att det är livsnödvändigt att ta sprutan, något som enligt min mening har ett annat syfte, nämligen att injicera ett medel att påverka och styra våra hjärnfunktioner med. Vad vi vet nu är att ett sådant medel är grafenoxid, som har just dessa egenskaper.
Det totala antalet avlidna är inte väsentligt högre under pandemiåren än jämfört med tidigare år. Detta indikerar, vilket vi också vet, att det förekommer falsk information från våra myndigheter om vilka som dör av Covid och varför. Läkare får betalt för att skriva Covid på dödsattesten trots att man egentligen dör av en konventionell sjukdom och statistiken förfalskas. Människor avlivas medvetet genom att välja fel behandlingsmetod, vilket ökar de påstådda dödstalen i Covid.
Man kan därför konstatera att pandemin är skapad med hjälp av en styrd media för att få igång vaccinationerna i syfte att få den elektromagnetiska mottagare på plats i våra hjärnor som behövs för att till stånd en långsiktig (inom tio år) depopulation av vår värld, sammantaget med beteendeförändringar hos dem som överlever.
För att genomföra detta underlättar det ju att ha ett virus, vars effekter blir påtagliga för befolkningen, men det hade gått ganska bra ändå eftersom injektionerna orsakar större skada än viruset självt. Detta förutsatt att man får fart på det påstådda vaccinationsprogrammet. Om viruset finns eller inte är därför inte huvudfrågan, det är innehållet i sprutorna och dess påverkan på våra kroppar som är det.
Det är också min åsikt – utan att kunna bevisa det – att de mediciner som Ivermectin som nu förbjuds av Cabalen eliminerar de skadeverkningar, som exempelvis blodproppar som orsakar dödsfallen, som är förutsättningen för depopulationen. Ivermectin dödar parasiter i kroppen och då också de grafenoxidbärande maskar och nanopartiklar som avses ta livet av oss. Men detta är bara en hypotes – än så länge.

Peter Krabbe

120 Responses to Om detta skola vi icke hava en åsikt…

  1. Eva says:

    Ja allting stämmer säkerligen.
    Ivermectin och Hydroxychlorocin förbjöds i USA för annars skulle inte nödgodkännandet gå igenom. Cabalen som såg det till att det skedde……
    Jo sjukdomen finns ju men är ganska mild hos de flesta. Lätt att bota med dessa enkla mediciner hos andra och enbart dödlig för ett fåtal äldre multisjuka.
    Ja jävlar vad världen blivit förd bakom ljuset med hjälp av media……

  2. sixtenshusse says:

    Inget annat än ett gigantiskt bedrägeri mot oss alla och jag hoppas att alla ansvariga (läs mördarna) får deras rättmätiga straff.

    • Jonas says:

      Det hoppas vi nog alla men tyvärr lär de komma undan denna gång också. Tror inget kommer att förändras förrän den dag Moder Natur slår tillbaka med full kraft men då lär vi alla stryka med, goda som onda.

  3. Loa says:

    Dr. Mikovits:
    Sars-cov-2 Is Actually a Lab-made Monkey Cell Virus, Readily Deployed Through the Flu, Mmr and Polio Vaccine Supply
    August 11, 2021
    https://www.naturalnews.com/2021-08-11-dr-mikovits-sars-cov-2-lab-made-virus-deployed-through-vaccine-supply.html

    (Natural News) Dr. Judy Mikovits was recently interviewed on Brighteon Conversations https://www.brighteon.com/dc43ea4a-e64b-42a4-8737-1efb436751b5 – 46 min. – and she did not hold back unveiling the real causes of transfection behind SARS-CoV-2 and the scientific fraud that was used to promote a pandemic and suppress people’s immune systems.

  4. Jonas says:

    De som har huvudet på skaft och sina hjärnor intakta insåg omedelbart för 1,5 år sedan att denna påstådda pandemi var märklig. Till att börja med hade jag stora problem med att förstå hur smittspridningen på bara ett par veckor kunde ha lagt hela världen under sig, visst reste vi då som aldrig förr men ändå ………. Sedan efter någon månad började jag undra varför det inte var fler döda i Sverige än tidigare år, om nu människor i stort antal blev sjuka och många dog av denna pandemi så borde ju detta slagit igenom i dödstalen. Sedan kom rapporter från andra länder som klart talade om att påstådda överbelägrade sjukhus inte hade en enda Covid patient eller bara ett fåtal. Sedan förbjöds de väl beprövade läkemedel som finns, Ivermectin och Klorokin trots att massor med läkare berättade om hur snabbt de botade Covidsjuka patienter. Parallellt fanns läkare och forskare i tiotusental som berättade att detta var en stor bluff och att Covid 19 var den vanliga influensan men de tystades. Till sist undrar jag så klart var de vanliga höst och vår influenserna har tagit vägen, har inte hört ett ljud om dessa på hela tiden, tydligen kan de inte samexistera med Covid 19 eller mer troligt är att Covid 19 är de vanliga influenserna.

    Det jag har allra svårast att förstå i denna masspsykos är hur våra länders ledare bara spelar med i denna parodi??

    • ceskyraj says:

      Jonas, väldigt bra sammanfattat. Jag har gått i första 4 månader förra året och trott att någon otäck smitta har spridit sig. Men när jag grävde mera i det hela och när med hjälp av olika källor kunde skaffa mig mera information, kunde jag se vilken bluff hela världen utsattes för. Till uppvaknande hjälpte Klaus Schwab med The Great Reset. Och Jacob Nordangård med sin bok Den globala statskuppen bekräftade mina upptäck. Jag chockades. Jag har många personer runt mig som är påverkade av denna masspsykos och lyder svensk MSM/myndigheter/politiker. Ju flera människor går på denna bluff, desto svårare blir det att väcka dem. Det verkar så att allt går enligt manus för Agenda21 och fortsätter mot Agenda30. Vad kommer att hända till vinter? Nästa år? Tvångsvaccination? Krav på vaccinpass för att jobba, handla mat, få pension (för min del), gå vård? Uppskjutning av valet?

  5. peterkrabbe says:

    Jag bryter ut denna viktiga text ur Loas länk ovan, skriven av Judy Mikovits och publicerad av Naturalnews. Judy vet vad hon talar om:

    Natural News) Dr. Judy Mikovits was recently interviewed on Brighteon Conversations, and she did not hold back unveiling the real causes of transfection behind SARS-CoV-2 and the scientific fraud that was used to promote a pandemic and suppress people’s immune systems. Dr. Mikovits was formerly a government virologist who purified and studied viruses. She created cell lines that support viral replication, to understand how they create infection in humans. She is the author of Ending Plague, A Scholar’s Obligation in an Age of Corruption.

    Dr. Mikovits confirmed that isolated, certified reference material for SARS-CoV-2 does not exist. The virus has never been isolated from human cells and was never a human virus in the first place. The SARS-CoV-2 virus can only be manufactured and replicated in the vero monkey kidney cell line, which is a group of epithelial cells extracted from African green monkeys in the 1960s. These monkey cell lines, readily contaminated with latent retroviruses, have been injected into the population since the mid-90s through the flu, MMR and polio vaccine supply, and are the only originating vector by which SARS-CoV-2 can manifest disease in humans.

    Evidence points to SARS-CoV-2 being deployed through vaccine supply
    Every bio-safety level 4 lab that claimed to isolate SARS-CoV-2 from humans ultimately placed the sample in a monkey kidney cell line to “prove” its replication. This virus is not a truly isolated human virus because it could only be replicated in the monkey kidney cell line. To determine whether SARS-CoV-2 is an infectious human virus, it must be taken from the blood, sputum, or lung lavage of an infected human, but the infectious RNA of SARS-CoV-2 was never cultured in a continuously growing human cell line that supports the replication of SARS-CoV-2. Since this novel coronavirus only replicates demonstrably in vero monkey cell lines, it has never been proven to originate or spread from human-to-human, let alone spread from healthy people.

    Since the current flu, MMR and polio vaccines contain these same vero monkey cell lines, the only way to deploy SARS-CoV-2 is through transfection via these needles. SARS-CoV-2 is a lab-made sequence that originates and spreads through the existing influenza vaccine supply. This could be why the Department of Defense discovered that flu vaccine recipients from 2017-2018 were increasingly susceptible to coronavirus interference.

    “When you take a synthetic part of a virus and you grow it in the monkey cells, you can get recombination events of all the monkey viruses, so it’s a monkey virus,” Mikovits confirmed, referring to the respiratory infections seen in covid-19. The HIV component comes from the Simian immune deficiency virus, which is also a natural monkey virus.

    The vector that promises to save humanity is the tool being used to transfect us
    Mikovits confirmed that Fauci knew about, funded and acquired cell lines and genetic material from biosecurity labs in the US that could be further weaponized in Wuhan. Mikovits said these virus experiments using the monkey cell line can create endless variants. “Two amino acid changes in the envelop of the spike can change a leukemia virus to a Parkinson-causing virus,” she said, citing her previous lab research. These sequences can be readily changed in the lab, creating endless variants of the same causative agent.

    Yet, the errors of vaccine science are easily blamed on nature, which is why Dr. Anthony Fauci and everyone involved in these unethical human-virus experiments are rushing to force and mandate new vaccines onto the population, to control the narrative and cover up their crimes. Dr. Fauci and Dr. Daszak coordinated with Big Tech to censor scientific debate on the origins of SARS-CoV-2, because their virus research is an error of vaccine science that has poisoned the population and primed people to new infections for years.

    Dr. Fauci and Dr. Daszak coordinated with media outlets and intimidated their colleagues into silence over the origins of SARS-CoV-2 because they were using no-see-um techniques to create these sequences in monkey cells. The no-see-um approach used in gain-of-function research, pressures the recombination process in the monkey cell line, and the resulting viral creation is unknown. Now the envelope of the virus, the S-1 sub-unit of the coronavirus spike protein, is assaulting the human population through the very vectors by which scientists like Fauci promised to save us. These new infectious sequences are in the cell lines which are then injected into the population via vaccination.

    For more insight into the science fraud, watch the interview with Dr. Mikovits on Brighteon.com.

  6. peterkrabbe says:

    Censuren kämpar på med att radera alla mina länkar till demonstrationerna i Paris och övriga Frankrike. Miljontals människor är ute på gatorna i fredliga manifestationer mot Macrons kriminella inskränkningar i människors frihet (dokumenterade av EU-kommissionen). I Sverige skall vi inte få veta någonting om dessa historiska folkrörelser, SVT censurerar liksom FRA censurerar allt på min blogg som visar pågående verklighet. Länken ovan är ett försök att få fram videon, får se om den når fram till någon…
    Man är uppenbarligen livrädd för att kommande demonstration på onsdag skall få inspiration av de tappra fransmännen.
    Idag inför Macron nya restriktioner innebärande att ovaccinerade inte får tillträde till varuhus med större yta än 2000 kvm, dvs i stort sett alla stormarknader.

    • Savalle says:

      STEG FÖR STEG – precis som när de unisont klädda munkarna med huvor som helt täcker deras huvuden i fulländad koordination marscherar nedför trappan i Madonnas uppträdande i ETC 2019.

      Det för mina tankar till inkvisitionen, då människor fördes fram till munkar iförda dräkter med med huvor som helt täckte deras huvuden och anklagades för kätteri. De hade inte rätten att tala till sitt försvar. De som inte medgav att de var kättare torterades svårt innan de avrättades.

      När Napoleon intog Madrid – och inkvisitionens högkvarter där – berättas det att till och med hans krigshärdade soldater, som sett mycket död och elände, kräktes när de uppsökte tortyrkammarna där.

      För den som orkar och vill försöka förstå vad som har drabbat minst femtio miljoner kristna ända sedan 1200-talet i inkvisitionens källarhålor rekommenderar jag boken Foxe’s Book of Martyrs, som var obligatorisk läsning i engelska skolor ända fram till dess Katolska kyrkan återtog kontrollen över det landet i mitten av 1800-talet.

      Foxe’s Book of Martyrs:

      https://en.wikipedia.org/wiki/Foxe%27s_Book_of_Martyrs

      https://www.bokus.com/bok/9780199236848/foxes-book-of-martyrs/

    • matte5958 says:

      Tydligt att ”räkan” Macron o Frankrike utsetts av cabalen att försöka genomföra detta vansinne. Av bilderna att döma kommer de inte lyckas!

      Förmodar att alla hjälm-klädda är poliser, som jag ser det så går de med i demonstrationen…

      Saknar de generaler som uttryckte missnöje över Macron & co, blev de kastrerade likt generalerna i USA eller vad ?

      Vill också (igen) rikta ett stort tack till Peter som driver denna förstklassiga blogg, definitivt i absoluta toppen i Sverige! Vi vet alla vilka risker du utsätter dig o dina för med bloggandet. Du är en stark människa !!

    • Loa says:

      Reuters: HALF of Paris Cafes And Bars Refusing to Comply With Vaccine Passport Scheme
      August 16, 2021
      https://stillnessinthestorm.com/2021/08/reuters-half-of-paris-cafes-and-bars-refusing-to-comply-with-vaccine-passport-scheme/

      • peterkrabbe says:

        Fransoserna håller emot så gott det går. Urvalet i denna undersökning med 10 caféer av de tusental som finns i Paris är nog lite väl magert, men det är viktigt att någon går först i ledet så följer resten efter. Macron avvaktar och spelar förstående, han vet att detta kan bli stubinen som antänder bomben. Det blir intressant att se hur denna mak5kamp utvecklar sig…

  7. Mjölner says:

    Efter denna kalldusch kommer här en ny.

    En mycket intressant artikel med historisk nazistisk bakgrund. Här avslöjas hur en nazistfamilj utnyttjade slavarbetare under WW2 och byggde upp en stor förmögenhet.
    I dag utnyttjar familjen dagens covid-hysteri genom tillverkning av vaccinationspass, som av allt att döma kommer inbringa nya miljarder.

    https://juliacaesar.blog/2021/08/16/okand-tysk-nazistfamilj-tillverkar-brittiska-vaccinpass/#more-24285

    • Eclipse says:

      Det var intressant. Fler som verkar utan att synas. Men tacka vet jag analoga vaccinpass. Hittade den här gamla godingen i en dokumentväska igår:

      https://postimg.cc/RNH82cTL

      https://postimg.cc/tYjwQsm0

      • Mjölner says:

        Eclipse!

        Min fru och jag har ett analogt vaccinationsintyg från 2006 gällande hepatit 2 när vi skulle resa till Egypten. Inte så gammalt men analogt. Det var ett krav då hygienen och vattenkvalitén i Egypten är undermålig. För att inte tala om deras skitiga pundsedlar som nästan kröp för egen maskin.
        Jag supportar tillfälligt Loa på nattpasset.

  8. ceskyraj says:

    Peter, du har kloka tankar. Jag håller med dig. Jag följer hela spektaklet från förra året och det snurrar snabbare och snabbare för varje månad som går. De som är mot, dör hastigt (4 st afrikanska ledare dom var mot WHOs påbud till covid-19 vaccin, Haitis president). Och konstigt nog Karry Mullis/uppfinnare av PCR test, dog i augusti 2019, ett par månader innan covid-19 utbrott i Kina. Det värsta är, att de ger sig t.o.m. på barn. Och idiotiska svenska PK människor och byråkrater i sin naiva iver hjälper till. Helt jävulskt. Som tex i Örebro lockas tonåringar till sprutor med disco. Hela världen är i psykos och länders politiker är med i Cabalas spel. Hur kan vi stoppa det? Hur ska det hela sluta? Mitt i det, händer andra händelser som att Afghanistan är åter i talibanernas händer som påverkar flyktingström till Europa/Sverige. Har Sverige ansvar för utveckling i Afghanistan? Sverige fortsätter vara hela världens räddare och kan inte ta hand om sin befolkning. Varför reser sig inte folket och gör uppror?

  9. matte5958 says:

    Ser ut som att ”räkan” Macron och Frankrike utsetts av Cabalen att gå i bräschen för restriktionerna. Av filmen att döma kommer de inte lyckas!

    Ser många hjälm-försedda personer (bör vara poliser) som såvitt jag kan se går med i tåget. Bara det säger väl vad utgången blir.

    Saknar de generaler som höjde rösten tidigare, kanske de desarmerats likt generalerna i USA? Hoppas de är kvar och fortsätter det de börjat = få bort marionetten Macron.

    Till sist; återigen stort tack till Peter som skapat och driver denna Sveriges troligen fförnämsta mötesplats för alla anit-globalister. Du tar stora risker och är ett föredöme Peter!

    • peterkrabbe says:

      Tack själv Matte och alla andra kommentatorer som hjälper till med material och synpunkter!
      Nej, poliserna deltar inte i demonstrationen. Tidigare bildade man mur framför demonstranterna i syfte att stoppa tåget, följden blev konfrontation och många skadade – även poliser trots sina rymddräkter. Nu har man insett att det inte går att stoppa dessa hundratusentals människor och deras protestmarsch och följer istället med på båda sidor om tåget för att avgränsa demonstranterna från hus, skyltfönster och caféer utefter färdvägen. Man minskar då skadegörelse och anlagda bränder som var vanligt tidigare.

  10. Loa says:

    Leaked Report Reveals Moderna Covid Vaccine Caused 300,000 Vaccine Injuries in Three-month Time Span, Hidden From VAERS
    August 16, 2021
    https://stillnessinthestorm.com/2021/08/leaked-report-reveals-moderna-covid-vaccine-caused-300000-vaccine-injuries-in-three-month-time-span-hidden-from-vaers/
    A leaked report from Moderna’s data collection company reveals that the Moderna covid-19 vaccines have caused upwards of 300,000 vaccine injuries in a three-month time span – dwarfing the number of vaccine injuries Moderna actually reported to VAERS in that time frame.

  11. Loa says:

    Gott och blandat i veckans Fulford
    https://benjaminfulford.net/2021/08/16/the-march-11-2011-attack-on-fukushima-and-its-aftermath/
    i synnerhet detta:

    The U.S. corporate government has external payment deadlines every September 30th and January 31st. (…) a two-week grace period lasting until February 16th, 2020 but were unable to make their payments.
    That is when all hell broke loose as we all know. The owners of the U.S. corporation lashed out with a massive 5G electromagnetic attack on Wuhan China. Remember, mass deaths began in Wuhan only after 10,000 5G transmission towers were activated, subjecting the population to deadly low-level electromagnetic attacks.

    US Corporation / KM / DS / Cabalen var alltså förbannade för att de måste betala sina räkningar. Väst har papperslapparna, Öst har guldet. Nu skulle ”snåla” Öst straffas med 5G:

    The official story that it was a “coronavirus” is provable nonsense. That is because if it was a biological attack, then the pandemic should have spread first to the suburbs of Wuhan and then to other parts of China. Instead, it was restricted exactly to the 5G zones inside Wuhan proper.
    After this, the spread of Covid-19 around the world coincided exactly with maps of where 5G networks had been activated.
    To understand 5G think of the defrost mode of your microwave. That operates at around 200 watts, while 5G is equivalent to about 30 watts. However, if it is transmitted 24 hours a day, it starts producing symptoms that resemble lung disease.
    Japan warned the world about this danger after they subjected 5,000 passengers aboard the cruise ship Diamond Princess to 5G and started getting multiple deaths. After this, all 5G was stopped worldwide.

    ?!! (Säg det till Umeå)

    So the Khazarian Mafia was forced to resort to plan B. They went ahead with medical martial law and started renaming influenza, the common cold, pneumonia and tuberculosis, and all sorts of other deaths as being from “Covid-19.”
    At the same time, they used their access to fiat money printing presses to pay huge sums of money to doctors to diagnose Covid-19. Since Western doctors operate under a military regime, they were told to go along with the pandemic story or lose their licenses.

    och propagandan:

    The Khazarian Mafia also used their corporate media to spread pandemic fear porn 24/7. Also, since the KM failed to kill their planned billions of people with 5G radiation, and since all their bio-weapons had proved ineffective, they next resorted to vaccines.

    Obs. att Fulford är en optimist. Stay tuned.

  12. Mo says:

    Josef Milered, barnläkare och ordförande i svenska skolläkarföreningen är kritisk mot FHM, han anser att även 12-15 åringar bör vaccineras.

    https://www.lararen.se/nyheter/coronaviruset/kritiserar-fhm-otydliga-besked-om-barnvaccinering

  13. åke says:

    Dr. Zelenko
    En av dem som tidigt såg stora risker med vaccinet mot SarsCov-2, och som fann en behandling som kunde räddat många fler i ett tidigt skede.
    https://americasfrontlinedoctors.org/videos/dr-zelenko-speaks-to-a-rabbinical-court-in-jerusalem/

  14. matte5958 says:

    En stilla fundering..

    Vi antager att cabalen lyckas med sina planer, NWO och Great reset genomförs. Våra (((vänner))) med sin ljusskygga religion som enligt dem själva ger dem gudomligt uppdrag att härska över världen och alla andra (=vi) goymer vinner.

    Det blit inte så roligt för oss. Vi måste komma ihåg att vi ses som likvärdiga med insekter, eller ohyra av våra (((vänner))), men detta håller de nogsamt hemligt; Talmud tål inte dagens ljus. Det är enligt Talmud belagt med dödsstraff för gojim (hedningar) att ta del av dessa skrifter: Vissa citat har dock läckt ut och återgivits av ledande ju___r, men de tenderar att raskt tas bort från nätet.

    Sanhedrin 59a:”En hedning som endast kastar ett öga i Talmud är dömd att dö, ty det är skrivet att detta är vårt arv, inte deras.”

    Ord och inga visor- inget kärleksbudskap där inte!

    Men säg att de lyckas och vi goymer, dvs egendomslösa slavar, är reducerade till bråkdelar av dagens antal, vi äger inget utan existerar bara för att tjäna de som härskar över jorden, hur lyckligt blir livet för de härskande ?

    Dagens samhällen med liv, entreprenörskap, företagande och livsglädje kommer bytas ut mot stadsbilden i Pyong Yang; tomma sterila gator, stela människor (=goymer) med tomma ögon utan liv…

    Hur roligt och trevligt blir framtida livet för de härskande ? De är ju trots allt liksom vi vana med att existera i dagens samhällen och dess strukturer.

    Men är man utsedda av (sin) gud så….

    • Erik says:

      Finns inget hemligt och det går utmärkt att studera Talmud och vem som helst kan anmäla sig för onlinekurs i Israel (gratis) om man vill fördjupa sig i Kabbalan (dubbad till engelska) via khanacademy vilket undertecknat gjort. Dock var det ganska lååångtåkit att lyssna till en skäggprydd Rabin i timmar. Det går snabbare att läsa samt lyssna till sammanfattningar via Youtube.

  15. Jonas says:

    Har också funderat lite i dessa banor, de rika vill ju bara bli rikare och det är på jordens folk som de blir rika, de blir ju inte precis rika på sig själva. Om de då utrotar en stor del av jordens folk så det bara blir några miljarder kvar så har de ju gått miste om massor av konsumenter. Känns ju lite som att de ”skjuter sig själva i foten”

  16. Sture says:

    För en vecka sedan startade Mike Lindell sitt symposium om valfusket i USA som löpte i 72 timmar under dagarna 10-12 augusti och som nu körs i repris under hela augusti. Ingen på bloggen har kommenterat detta med ett endaste ord. Ändå tror jag att detta är något av det viktigaste som skett för hela världen. En del helt fantastiska föredrag och lärdomarna är nu sammanfattade i en ”playbook” för att alla counties i USA (f.n. 3.143) skall veta hur de skall gå tillväga för att riva upp allt valfusk i sina egna counties.
    Fusket är satt i system i hela världen och därför är kunskapen om hur man går tillväga med hjälp av de digitala maskinerna livsavgörande för världens öden.
    Brasilien har just nu blivit utsatt för exakt samma sak varför förre presidenten Bolsanaro skickat sin son att delta. Symposiet hölls i Sioux Falls i SouthDakota och man gjorde flera försöka att angripa och störa,t.o.m. med våld men lyckades inte.

    Vi känner till hur Kina förde över 10-15 miljoner röster via Italien och nätet från Trump till Biden. Nu vet man också hur algoritmerna för de digitala röstmaskinerna såg ut – i varje county. Dr. Frank, fysiker till yrket, kunde exakt förutsäga röstetalet för varje åldersgrupp i varje county. Hur gick han tillväga?
    Han fann att visste han bara vilket antal människor som bodde i varje stat enligt 2010 års folkräkning, så visste han också hur många som man ansåg vara registrerade, nämligen 86%. Detta var ett fixerat tal. Och om man visste hur många som var registrerade så visste man också hur många som ansågs finnas där enligt rösträkningen 2010. Det är härifrån alla ”döda som röstat” kommer.
    Sedan hade algoritmen delat upp befolkningen i 83 kategorier från ålder 18 år till 100 år. Varje stat hade sedan fått en algoritm för varje åldersgrupp i denna stat (=83 stycken) och denna algoritm gällde för VARJE COUNTY i denna stat. Detta är naturligtvis mycket suspekt och kan inte ha tillkommit av en slump. Nästa stat hade fått en annan algoritm för varje ålderskategori och denna algoritm gällde för VARJE COUNTY i denna stat. Så där har det hållit på och detta är ett alldeles uppenbart BEVIS för valfusk på grund av de digitala valapparaterna.
    Alla de valförrättare som ansåg att detta val var ”det säkraste valet i USAs historia” fick sig en ordentlig tankeställare när dr. Frank kunde förutsäga alla valresultat för varje åldersgrupp bara han fick reda på antingen folkräkningsresultatet 2010 ELLER antalet valregistrerade. När dessa insett att detta var ”mystiskt” har de velat hjälpa till att utreda detta. Det kommer att hållas audits om valresultatet i varje stat.
    På symposiet var lagfattare från alla USAs 50 stater närvarande – och detta kommer att få en efterföljd. Detta handlar inte om Demokrater eller Republikaner utan om hela världens rättighet att kunna välja sina ledare.
    Jag är övertygad om att vi kommer att få en Domino-effekt och huvuden kommer att rulla. Kontentan av detta symposium var att det är hög tid att släppa sin rädsla och att kliva fram. Det var underbart att höra deltagarna uttala detta: det är hög tid att släppa sin rädsla och istället kliva fram. Vi är många – de är få. Och de tål inte dagens ljus.

    • peterkrabbe says:

      Tack för att du bevakar detta. Vi önskar nog alla att Trump skall återinsättas som president så fort som möjligt och det tycks fortfarande finnas en möjlighet till detta. Att vänta fyra år på nästa val är omöjligt. Vad Trump i så fall skulle kunna göra för att stoppa eller förändra pågående utveckling återstår att se. Det är svårt att glömma att han faktiskt hade Fauci på posten som dirigent för hela vaccinationskampanjen, trots sina positiva erfarenheter av alternativ medicinering. Alltför många överlöpare finns fortfarande i kongressen, något som kommer att bestå ett par år till oavsett president. Vi får hoppas på det bästa…

    • Loa says:

      Jag kommenterade det, inkl rumble-streamen och attacken på Lindell.
      Loa says:
      14 augusti, 2021 kl. 01:21

      The TRUTH vs The Big Lie
      Cyber Symposium Reveals Shocking New Data
      August 12, 2021

    • Loa says:

      Då får vi hoppas att detta är dödsryckningar av Dpt of Homeland Security

      DHS Issues ‘Terror Alert’ for Americans Who Question 2020 Election, Resist COVID Measures & Celebrate ‘Religious Holidays’
      August 14, 2021
      https://beckernews.com/dhs-issues-terror-alert-for-americans-who-question-2020-election-resist-covid-measures-celebrate-religious-holidays-40857/

    • Erik says:

      Sture, flitig som vanligt läser jag… Också jag tackar för detta. Man ska inte sprida defaitism, så även jag håller tummarna så att Stures prediktioner vinner laga kraft.

  17. Mjölner says:

    Vi måste jobba med upplysning från olika håll och på olika sätt för att kunna bryta ned och avslöja globalisttrollens lögnfabrik. Just nu har MSM fått en gratiskuliss att hålla upp för att kunna dölja de verkliga sanningarna, den heter AFGHANISTAN. Gå inte på den finten. Biden och Kina är två av hantverkarna bakom den katastrofen. Vad blir nästa, Taiwan?
    Därför länkar jag till en viktigare uppgift, tag vara på er hälsa och er själva.

    https://anthropocene.live/2021/08/16/d3-vitamin-och-zink-minskar-risken-att-insjukna-i-covid-19-med-90/

  18. Mjölner says:

    OPINION. Marcel Westerlund som är specialistläkare i Nya Zeeland gör ett intressant uttalande på Facebook. Han skriver om hans upplevelser av covidrestriktionerna som resenär och från sin egen karantän. Westerlund kommenterar även vad han anser är covidkrisens egentliga syfte.

    https://newsvoice.se/2021/08/marcel-westerlund-den-totala-revolutionen/

  19. Mjölner says:

    En fullträff om den s.k. statsministerns mentala tillstånd.

    https://bakomkulisserna.biz/2021/08/18/en-sadan-individ-kan-omojligen-vara-frisk-mentalt/

  20. Jonas says:

    Idag hade min avdelning teamsmöte på jobb och i slutet av mötet blev det sagt att vi snart ska kunna gå tillbaka till fysiska möten då det är trevligare att sitta tillsammans i ett mötesrum. En kollega ( en hysterisk och vaccinerad sådan ) gjorde då gällande att om vi ska ha fysiska möten så måste vi diskutera hur de som inte är vaccinerade ska hanteras, de ska kanske inte tillåtas vara med på fysiska möten då de utgör en hälsofara för de andra. Kollegan gjorde också gällande att företaget kanske skulle ta fram en lista på de som inte är vaccinerade så man vet vilka de är.
    Jag har känt detta komma och nästa steg är att ovaccinerade inte får befinna sig fysiskt på arbetsplatsen vilket i förlängningen innebär att man inte kan utföra sitt arbete på ett tillfredställande sätt och då får man sparken.

    Jag arbetar på ett kommunalt företag och där framhåller man dagligen att ingen får utsättas för kränkande särbehandling. Vi har till och med undersökningar 2ggr per år där man får svara på frågor om man har utsatts för kränkande särbehandling och från ledningen har man uttryckligen sagt att dessa frågor om kränkande särbehandling måste bli 100% dvs. ingen får känna sig kränkt eller särbehandlad, aldrig någonsin.

    Så mycket för dessa värdeord.

    Vill tillägga att självklart är kollegan en av alla som alltid står upp för alla minoriteter och alla som blir kränkta och särbehandlade, det slår aldrig fel, jä_la hycklare.

    • Erik says:

      Jonas, framför det motsägelsefulla samt ologiska i detta resonemang, och säga att du undrat lite om det ens är seriöst menat – varför vaccinera sig om man ändå är rädd för att bli smittad av ovaccinerade?

      Syftet med att ta vaccin måste väl ändå vara att skydda sig från dom som kan smitta en, dvs de ovaccinerade? Om man fortfarande kan bli smittad som vaccinerad, vad är visten i så fall att ta vaccinet? Om de som framför detta (inte vill/vågar/kan umgås med ovaccinerad) så ställ frågan så här: vad vore skillnaden om alla vore ovaccinerad? Inget enligt deras eget resonemang? Det verkar på mig som om de inte ens själva tror på vaccinets förmåga att skydd dom. Varför vaccinera sig, om vaccinet ändå inte ger dom skydd?

      Framför att ni är överens och har något gemensamt här – ingen av er tror på att vaccinet kan skydda er.

      • Jonas says:

        Det är min poäng i klartext, varför vaccinera sig om man ändå inte tror sig vara skyddad. Ännu vansinnigare är det att vaccinera sig flera gånger och ändå springa omkring med masker, hålla distans och vara rädd för att bli smittad för en påstådd ”pandemi” där dödligheten ligger i nivå med de vanliga säsongsinfluenserna. Hela världen har blivit galen, jag väntar nu bara på zombie apokalypsen där de vaccinerade springer runt på gatorna och tar livet av de ovaccinerade.

    • Jonas says:

      Jag tog upp detta med chefen igår och sa att jag känner mig kränkt av resonemanget och ser en särbehandling komma för oss som inte vaccinerat sig. Han gav intryck av att vara förstående och när jag drog mina argument för att inte behöva vaccinera sig sa han att han inte kände till alla dessa omständigheter men tyvärr var det så att media framställer Covid 19 som något oerhört farligt och att det finns flera stycken på arbetsplatsen som är i riskzonen och mycket rädda för att bli sjuka och att företaget måste följa de restriktioner som finns och kan komma. Lite senare kom en kollega och pratade och han sa bl.a att det var alla ovaccinerade som skapade mutationerna och så länge de ovaccinerade vägrar vaccinera sig så kommer Covid eländet att fortsätta så med andra ord är allt ont som händer de ovaccinerades fel. Jag upplyste honom i skarpa ordalag att han har helt fel och att mutationerna uppkommer på grund av vaccineringarna och att det är mycket bättre och säkrare och effektivare att bli smittad och utveckla ett naturligt immunförsvar. Därefter mailade jag honom några länkar.
      Det är ju helt klart att mainstream media är den stora boven i detta drama, hur ska vi komma åt dem?

    • Ron says:

      Funderat på att säga upp dig?

  21. Jag vill spinna vidare på det Du refererar Peter 16 aug 13:01 från J. Mikovits.
    Ett nytt vaccin har sett dagens ljus, som Loa och Mo kommenterade i Ditt förra inlägg, Novavax eller NVX-Cov2373. Det är, som angett av Mo, ett s.k. proteinvaccin, där proteinet är ‘spike’-dito med Matrix-M1 som adjuvens. Vad är det för fel på detta?

    • Först en referens till Mikovits grundtema om apvektorn , SV40 kontaminering och multiplicering av detta i efterkommande vacciners adversa effekt. NVX är tillverkat via baculovirus och celler för majsfly. Spikeproteinet har först infogats i detta specifika icke-humana virus som därefter tillsatts laboratoriemässigt i ovarieceller från den specifika nattfjärilens könsceller för multiplikation. Därefter har dessa spikproteiner skördats och samlats upp,14 i taget, och infogats i en lipidbur tillsammans med adjuvensen. När dessa spikptoteiner injekteras i människor följer de vågfunktioner, som är specifika för det använda baculoviruset resp ovariecellerna för majsflyet, med in i kroppen. De hör inte hemma hos människor och kan ge samma ‘vektor’- initierade felfunktioner som apvektorn enligt Mikovits forskning visat.

    • Matrix-M1 innehåller barrextrakt av såpnejliketrädet Quillaja saponaria Molina tillsammans med fosfolipider och kolesterol. Aj då, saponiner är giftiga vid direktinjektion. Pilgift innehåller saponiner. Om Du träffas av en ‘sådan pil’ dör Du, eftersom saponinerna ger hemolys, dvs.höggradig förstörelse av röda blodkroppar. Saponiner som intas oralt tas om hand av ‘metabolismen’ och göres icke-toxiska. Direktinjektion är att likna vid en pil.

    • De 14 spikproteinerna lägges alltså tillsammans med saponinerna i en kolesterol/fosfolipidbur. De anges ha storleken 40nm, tillräckligt små för att kunna gå in i lymfsystemet, där de avges för mediering av T-cells immunrespons. Det sker genom saponinernas försorg, som ger cytokinstorm. Storleken är tillräckligt liten för ev. passage genom blod/hjärnbarriären. Huruvida det kan ske eller inte är jag osäker på. Det som talar för det är ‘skalet’ kring de 14 spike-proteinerna, som innehåller kolesterol. Kolesterol, som är ett slags hormon, låter blod/hjärnbarriären passera. Inte vill väl någon riskera dels hemolys i hjärnartärerna dels direktinjektion av spike-proteiner i hjärnan?

    • Så har vi de vanliga problemen med immunrespons på ‘spiken’ själv. Spike-proteinern i NVX har samma potentiellt destruktiva verkan som dito via ex.vis. mRNA-tekniken. Genom igenkänningfaktorn, s.k. molekylär härmning, kan vårt immunsystem vid aktivering omedelbart eller senare ge sig på och förstöra sådana proteiner, vilka kroppen behöver för felfri funktion, som innehåller exakt samma nukleinsyresekvens som spike-proteinet har. De är potentiellt många, eftersom den exakta nukleinsyresekvensen förekommer som kromosomdetalj på 70-86 olika ställen i det mänskliga DNAt. Det har vi tagit upp tidigare här på bloggen.Jag har antecknat ‘dödsspikens’ sekvens:
    TTGGCAAAATTCAAGACTCACTTTC

    Det är alltså detta vaccin som den svenska regeringen var så ivrig att teckna leveransavtal för. Det är ännu inte nödgodkänt, men det är säkert endast en ‘kort’ tidsfråga. Hugavale!

  22. En annan says:

    Det händer grejer fast journos sover på sin post…
    https://www.armstrongeconomics.com/international-news/disease/sotrovimab-the-alternative-to-mrna-vaccines/
    Men håll tyst om detta alla köpta låssasjournalister ity, det kan kosta er en bostadsrätt på södermalm…

    • peterkrabbe says:

      Sotrovimab tycks kunna vara ett alternativ till vacciner, baserat på antikroppar tagna ur blodet på tillfrisknade efter Covid. Men om nu immuniteten efter naturligt tillfrisknande bara varar drygt halvåret bör väl detta gälla även Sotrovimab? Kanske är detta bara ett sätt för läkemedelsindustrin att behålla initiativet för att få fram nya patent i sprutform som ger möjlighet till ”kompletteringar” av innehållet? Vi får se hur detta utvecklas…

      • Mo says:

        Det pågår en studie på Danderyds sjukhus, Community-studien, som tittar på hur naturlig immunitet utvecklas efter Covid infektion.
        Det är mycket positivt med data som pekar på bred bestående immunitet. 96 % av deltagarna har fortfarande efter 9 månader mätbara nivåer av neutraliserande antikroppar. Hos 2/3 av dessa har uppmätts specifikt T-cellsminne. Vid upprepad testning för återinfektion har virus bara hittats hos 1 % vilket talar för mycket liten risk att bära på virus och föra smittan vidare, till skillnad från immunitet uppbyggt med vacciner.

        https://nyheter.ki.se/bred-immunitet-mot-covid-19-efter-9-manader

  23. En annan says:

    2Det som gäller nu är att skademinimera människor från skadliga injektioner, kanske denna upptäckt kan hjälpa;https://www.biorxiv.org/content/10.1101/2021.03.19.435959v1.full

    • Loa says:

      Maskros! Undrar om maskrosvin skulle kunna ingå i medicinskåpet?

      • carinaagrellgmailcom says:

        Det kan det säkerligen! 🙂 Det är dock beskan i roten som gör susen, men maskrosblommor är säkert också nyttigt, vilket jag vill minnas att man gör vin av?
        Maskrosvin blir starkt, så om du inte vill lulla runt hela tiden, kan du testa med Solgars Dandelion Root, 100 kapslar för 169 kr:
        https://www.svenskhalsokost.se/sok?s=dandelion%20root%20%20%20maskrosrot

      • Mo says:

        Loa, en god ide. Maskros användes som medicinalväxt i det gamla Kina och Egypten för sina blodrenande egenskaper och vid infektioner. Maskros blomman representerar under olika faser av sin livscykel himlakropparna sol, måne och stjärnorna. En formula med Trismegistus kraft ?

        • Loa says:

          Här blir det väl mest den strålande solen som gäller..
          Maskrosvin sättes på prunkande nyutslagna blommor, avnupna före kl.12 – INGEN stjälk – en balja full över vilken hälles lika volym kokhett vatten. Minns ej när det silas; socker tillsättes, ingen jäst! Puttrar av sig själv ett par veckor – Nu fick jag väl spritmonopolet på mig.
          Täckes med citronskivor, minns ej heller när. Sila genom melittor.
          Blir tjockt som sherry men smakar öl!

          • Erik says:

            Har också gjort maskrosvin, ett jävla slit att samla in alla blommor. Vi ställde de hos kompisens farsa, bara det att han var alkoholist och slangade ur hela damejeannen.

      • åke says:

        Även ”gurgelvatten” som Povidone-lodine har bevisad effekt i ett tidigt skede, liksom munspray/inhalator Budesonide (astma-med.)

        Men skall man överhuvudtaget använda profylaktiska vacciner mitt i en pandemi ?

    • peterkrabbe says:

      Intressant att kineserna (?) ser vårt ogräs maskrosen som medicinalväxt, men detta är ju ganska typiskt för vår Big Pharma- styrda civilisation. Kanske Sture kan utvärdera om artikeln är relevant eller bara ett hugskott? Väntar med spänning på om jag kan börja skörda maskrosorna i min gräsmatta som medicin mot Covid…
      Allvarligt talat är det ju så att det mesta vi behöver för att må bra redan finns i naturen, serverat av vår Skapare. Det som konsekvent har sopats under bordet de senaste hundra åren, främst med Rockefellers hjälp, är kunskapen om detta naturens apotek. De som bättre än någon annan ( tänker inte på kommentatorn) bevarat denna kunskap är ju just kineserna, så detta är säkert värt att utvärdera bättre?

      • Minns kineskvinnan som fick nobelpris 2015 tror jag det var för att hon plockade fram ett gammalt recept på malört. Som är bra mot malaria. Men örten är även bra mot parasiter och mask. Vi behöver mer bittra örter i våra förstörda matsmältningsvätskor som lätt förlorar sitt bett. Och då kan man inte smälta maten på bästa sätt och så blir man sjuk. Då kryper det ut gifter i kroppens största organ – huden – bl a. När inte lever och njurar klarar av att avgifta kroppen.
        Kort kan man säga att maskrosen är bäst för levern och nässlan gör sitt på njurarna. Men om du tittar kanske du t o m har gåsört i gräsmattan. Det har jag! På min blogg har jag skrivit om örter i boxen Växter. Kolla där! Här lite om gåsörten:

        Bladen (året runt): Användbar som medicinalväxt. Duglig som föda. Ett avkok på bladen från gåsört sägs vara bra mot hemorrojder (utvärtes). Avkoket kan även drickas för att avhjälpa besvär med matsmältningen. Bladen går att äta, även om de energirika rötterna vanligen är det man främst äter hos gåsörten. Bladen kan dock ge ett bra tillskott av vitamin C. Örten används inom folkmedicinen mot menstruationssmärtor och roten har ansetts verksam mot inflammationer i tandköttet.

        https://parnassen.wordpress.com/2015/06/16/potentill-anserina-gasort/

        • Eclipse says:

          Agnes Wold i P1 idag:

          ”Jag tycker ju inte om örter, de kan ge alla möjliga allergiska reaktioner.”

          https://www.nobelprize.org/prizes/medicine/2015/7574-pressmeddelande-2015/

          • Sjuka människa! All medicin kommer från naturen! Fy fan! 😛

            • Jonas says:

              Var det inte Sokrates som lär ha sagt att ”låt maten bli din medicin” ?
              Ett annat modernare uttryck är ”du är vad du äter” vilket förklarar fettma epidemin.

              • Nej, det var den här mannen!
                Hippokrates, född på Kos cirka 460 f.Kr., död 370 f.Kr., var en grekisk läkare. Han är en av de mest framträdande personerna i medicinens historia. Han kallas ”läkekonstens fader” för sina bestående bidrag som grundare av den hippokratiska medicinska skolan som revolutionerade läkekonsten i Antikens Grekland.

          • Savalle says:

            Agnes Wold är kanske en av dem som agnats av läkemedelsindustrin och som med berått våld nedsligt våldför sig på sina medmänniskor och sanningen.

            Här berättar den före detta mycket högt uppsatta direktören på ett av världens största läkemedelsbolag, Peter Rost, hur han i egenskap av ansvarig för marknadsavdelningen sökte ut extremt mutbara läkare. De gjordes till språkrör för företaget genom att ges en falsk aura av auktoritet och objektivitet, men allt de sade och skrev var helt styrt av bolagets marknadsintressen.

            Hera deras formella forskarutbildning ombesörjdes av utbildningsbyråer som anlitades av bolaget. Alla avhandlingar och publikationer var skrivna i de korrupta läkarnas namn men av konsulter i utbildningsbyråerna och allt var kamouflerad reklam för bolagets produkter.

            Så dessa köpta läkare var inte endast lögnaktiga bedragare, utan hönor med lånade fjädrar!

            Här intervjuas Peter Rost vid ett flertal tillfällen. Det är en mycket klarläggande dokumentärfilm!
            https://www.artimus.se/whocaresinsweden/sv/film-three.php
            (Lögnen)

            När det gäller ”professor” Agnes Wold så är den här artikeln av Lars Bern mycket bra!
            https://anthropocene.live/2019/09/03/agnes-wold-pratar-i-nattmossan-som-vanligt/

      • Loa says:

        Maskrosbladen kan du ha i sallad. Men det är kanske vårens skörd som avses..
        https://www.land.se/recept/alska-ditt-ogras-gor-underbar-sallad-av-maskrosor/

  24. Erik says:

    Här förklaras den farligaste av alla psykiska tokigheter: masspsykosen, som är att liknad vid en galenskapsepidemi som uppstår när samhället tappar kontakten med verkligheten och istället drunknar i vanföreställningar. Ett exempel på masspsykoser är 1500- och 1600-talets häxprocesser samt kollektivismens totalitarism under 1900-talet.

    Vad är en masspsykos? Hur skapas en sådan och var och hur startar allt egentligen? Upplever vi en just nu?

  25. Mo says:

    Nu börjar urskiljningen, M vill införa vaccinpass så att dubbelvaccinerade kan återgå till ett normalt liv ! De anser även att barn 12-15 år skall vaccineras.

    https://www.aftonbladet.se/nyheter/a/Rr1eMA/moderaterna-vill-se-vaccinpass

    • Loa says:

      Trots riskerna – nu kräver lärarfacket att barn vaccineras
      19 aug. 2021
      https://nyadagbladet.se/inrikes/trots-riskerna-nu-kraver-lararfacket-att-barn-vaccineras/
      Till kärringkören sällar sig vår tusenkonstnär Matti med försåtligt hit-och-dit-snack.

      Matti Sällberg, professor i biomedicin vid Karolinska institutet och ordförande för Svenska Vaccinfabriken Produktion AB samt styrelseledamot för farmaci-leverantören Prebona, säger till SVT att svenska barn mycket väl kan komma att covidvaccineras inom en snar framtid. Han konstaterar samtidigt att de flesta barn som smittas av viruset blir lindrigt sjuka och ofta nästan helt symptomfria, men menar att det ändå är smittspridningsnivåerna som kommer att bli avgörande.

    • Mjölner says:

      Loa!
      Danmark tänker skrota alla restriktioner gällande Cov,-19 Osanna rykten? Nya Dagbladet.

      • Erik says:

        Nej det stämmer. Kollade senast i går, allt som krävs är en antigentest (tas i näsan) sedan är det fritt fram för en svensk att a sig in i Danmark – tillbaka till Sverige kring ingenting.

        Var själv över förra året till Bornholm för att hälsa på Öystein Rönne samt tillsammans med dansk mäklare titta på några gårdar vi var intresserade av; sedan slog vansinnet till som bekant och planerna på att flytta lades på is.

  26. Mo says:

    Vilken korkad retorik, får vi inte skicka tillbaks unga män till Afghanistan pga kvinnoförtrycket där. Är Adaktusson rädd att de hemkommande skall öka på förtrycket. Men om de stannar i Sverige och svenska kvinnor blir offren då är det ok ?

    https://omni.se/amnestifragan-splittrar-kd-ar-rimligt-att-diskutera/a/ML5baK

  27. Mjölner says:

    Det som nu pågår över hela klotet och når offentlig kännedom Cov-19, vaccin, barnvaccinering, vaccinpass, nationer i skräck, karantänläger, nedstängningar, munskyddstvång, konflikten i Afghanistan, när kommer finanskrisen etc. etc.sysselsätter de flestas tankar och styr vårt handlande.

    På denna blogg ventileras de flesta aktuella ämnena t.o.m. maskrosors eventuella nytta.
    Bakom dagens skeende finns regissörer. I vårt land Sverige styrs skeendet av två familjer
    Wallenberg och Bonnier. Wallenbergs inflytande är dessutom världsomspännande Wallenberg som permanent medlem i Bildebergsgruppen och genom de stora företagen ABB, Ericsson, Atlas Copco, SAAB, Astra Zeneca och Enskilda Banken SEB.

    Alla tekniska företag som Apple, Google, Amazon, Facebook, Twitter, Microsoft etc har sina serverhallar i Sverige och betalar förmodligen licensavgifter till Wallenberg för att vara tillgängliga på internet. Dessutom erhåller dessa stora elförbrukare kraftiga rabatter på elräkningen av staten.

    De mäktiga familjerna Wallenberg och Bonnier har troligen ett ”Gentlemen’s agreement” där de gått ur vägen för varandra. Wallenbergs har varit nöjda med att få styra industrin och Bonnier media. Kuppen när bulvanen Proventus tog över TV4 för Bonniers räkning är i färskt minne.
    Alla som tittar på TV4 får lida för den kursändringen.

    Wallenberg har varit extremt framgångsrik i vårt land, hela det politiska etablissemanget övergav sina gamla idéer och värderingar för att sluta upp bakom det globalistiska programmet. The New World Order (eller FN Agenda 2021/2030).
    Wallenbergs ser till att dessa korrumperade politiker blir rikligt belönade för landsförräderiet mot det svenska folket. Esse Non Videri, verka utan att synas.

    Det är mycket svårt att förstå hur svenskarna kan vara så intellektuellt paralyserade att de inte reagerar för detta fögderi. Dessa två familjer i symbios med korrumperade och klent begåvade politiker har begått och begår grovt landsförräderi mot svenska folket.

    I den rättegång som kommer efter globalismens kollaps och världens tillnyktrande, där förbrytarna ställes till svars, kommer dessa två familjer att dömas mycket hårt.

    • Eclipse says:

      Egentligen betyder valspråket ”Att verkligen vara, inte att synas vara”, d v s att det man utger sig för att vara inte bara är en fasad. Vet inte hur den förvrängda översättningen ”verka utan att synas” uppstått, men visst, det är ju så de agerar. Man kan ju tolka även det uttrycket som ”Vi skänker pengar till forskning och samhällsuppbyggnad utan att skryta med det.”

      Att som en osynlig parasit suga ut samhällskroppen tills allt av värde är vårt ligger väl närmare sanningen.

      • Mo says:

        Det var väl under en tid med industrialismen och stora samhällsförändringar i pågående och antågande. Bla gjorde både bolsjevikerna och nationalsocialisterna anspråk på att med industrins hjälp utveckla det utopiska samhället. Det är så jag tror att man skall uppfatta det, något med substans och inte bara flosker.

    • carinaagrellgmailcom says:

      Tack för kort men belysande sammanfattning!

    • Loa says:

      Mjölner
      Fantastisk översikt / sammanfattning, tack! Knutson, stick och brinn.

      Jag har hört att de globala energisugarna får betala 1/40 pr W för vår knappa ström jämfört med oss. En sån hävstång för Mållgan. ”Censurera eller jag höjer priset!”

      Ja, allt som inte är stasivisionen är bonnierkanaler. Med reklamsjok (och vilken reklam) om tio minuter – vad är affärsidén..? Katalysator att få ändan ur soffan.

  28. Jonas says:

    Näst sista stycket har jag också svårt att förstå men vi talar om ett naivt, lättlurat, godtroget och fördummat folk. Dessutom fredsskadat då vi inte haft något krig eller konflikt i landet på mer än 200 år.

    Ditt sista stycke är en våt dröm, ursäkta uttrycket men jag håller tummarna för att det verkligen blir så.

  29. Jonas says:

    Kan någon smart person ( finns många här ) förklara hur vaccinet fungerar för jag får inte ihop det?

    Som jag förstår mobiliserar vaccinet ( tvingar igång ) kroppens immunförsvar. Men om jag då vaccinerar mig utan att vara smittad så har ju kroppens immunförsvar inget Covid 19 virus att oskadliggöra. Hur länge går det mobiliserade immunförsvaret på högvarv, tills man blir smittad eller?? Immunförsvaret kan väl inte gå på högvarv tills den dag man blir smittad av viruset.

    Som sagt, det finns så många förklaringar och vinklingar på detta så jag förstår ingenting.

  30. Mo says:

    Mjölner, jag är överens med dig när det gäller Bonnier, de köper upp mindre tidningar, koncentrerar och monopoliserar media branschen. Mycket olyckligt inom ett sådant område där mångfald är förutsättningen för demokratins bestående och utveckling.
    Däremot kan man väl säga att Sverige som en blomstrande industrination till stor del var Wallenbergarnas förtjänst. Men det är sedan många år utförsgång som gäller och det är svårt att se vilka av storföretagen som står sig i konkurrensen och framförallt inte blir uppköpta av amerikanska kapitalförvaltare.
    Ser det inte ganska dystert ut för svensk del ?
    En sak är säker, utan svensk export hamnar vi på nytt i fattigstugan.

    • Mjölner says:

      Det är sant att Wallenbergs även bidragit till svenskt välstånd och spetskunskap genom de stora företagen. Lars Magnus Ericsson grundade LM Ericsson Telefon AB vilket köptes upp av Wallenberg. Så har det väl gått till flera gånger genom Investors aktieaffärer. Wallenbergs största förtjänst är näsa för goda aktieinköp inte för grundande av företag. När man väl slagit klorna i ett bra objekt tar man åt sig all ära för framgångarna. Gräddan av svenskt företagande har redan lämnat landet.

      När nu elkrisen blivit ett faktum flyr företag Sverige då södra delen av landet inte får köpa någon el norrifrån. All el i Norrland går åt till att göra stål med den nya moderna miljömetoden samt elförsörjning till alla dessa serverhallar. Miljöpartisterna vill låna obegränsat till allting.
      Det är ju nästan gratis att låna pengar enligt Karolina Skog MP. Hur och vem skall betala tillbaka? Stolleriet saknar alla gränser.

      • Mo says:

        Vi får hoppas att Ericsson förblir svenskt men det är tufft därute idag. Lars Magnus Ericsson uppfann inte telefonen men han fick möjlighet att starta upp tillverkning i Sverige tack vare att patentet ( Bells ) inte omfattade den nordiska marknaden. Medvetet eller ej, vem vet ?

      • Mo says:

        Den nya ståltillverkningen i Norrland skall visst använda sig av bla vätgas som energikälla. Tyskland blir väl troligen storkund. I de nordliga områdena kommer det finnas gott om el från Finlands nya kärnkraftverk med en teknik som måste uppfattas som säker och miljövänlig, men det kanske inte är tillräckligt för Skog.

    • Savalle says:

      Sverige som en blomstrande industrination var ABSOLUT INTE Wallenbergarnas förtjänst.

      Däremot förstörelsen! Med alla sina pengar skaffade de kontroll i bolagsstyrelserna och satte in samvetslösa typer som verkställande direktörer och styrelseordföranden, typ Gyllenhammar, som hamrade sönder företagen, vars smulor sedan köptes upp av storbankernas multinationella företag för peanuts..

      Lars Berns bok ”Varför försvinner våra kronjuveler? : dikeskörningar i svensk industri” visar detta.

      Sverige som en blomstrande industrination, tidigare, var ett resultat av relativt stor näringsfrihet och frihet från krig.

  31. Sture says:

    Lyssna på ett av de många för motståndsandan verkligt stimulerande talen på Mike Lindells Symposium om valfusket. David Clements är professor i juridik och han skräder inte orden, trots att detta tal kanske gör att han får sparken från sin professorstjänst – han vet inte. Och det han säger – alla måste kliva fram. Vi har inte råd med feghet – som den som många av domarna i Högsta Domstolen uppvisar:

    • Savalle says:

      Ja, domarna i högsta domstolen i USA kan tyckas fega! Jag skulle hellre vilja framhålla att de är korrumperade. De har inte sin lojalitet i fosterlandet, utan i den romersk katolska religion som indoktrinerat dem.

      Det senaste tillskottet:

      Amy Coney Barrett är en katolik, utbildad vid det katolska elit-universitetet University of Notre Dame – och likt varje hängiven katolik är hennes lojalitet Vatikanen i Rom, inte folket i USA.

      Och nu dominerar katolikerna USA:s högsta domstol – så ALLA statsmakterna i USA, presidentämbetet, kongressen, senaten, högsta domstolen, massmedia (och dessutom FED!) lyder nu under Rom.

    • Loa says:

      BIG — Jovan Pulitzer: Arizona Audit Report Will be Delivered to Senate on Friday, Results Will Be Earth-Shattering
      August 19, 2021
      https://stillnessinthestorm.com/2021/08/big-jovan-pulitzer-arizona-audit-report-will-be-delivered-to-senate-on-friday-results-will-be-earth-shattering/
      .
      .

      Jovan Pulitzer Reveals It’s Not the ‘Watermarks’ on the Ballots – It’s Better (VIDEO)
      August 18, 2021
      https://www.thegatewaypundit.com/2021/08/jovan-pulitzer-uncovers-not-watermarks-ballots-better-video/

      It Wasn’t Watermarks They’ve Been Looking For. It’s Much, Much Better!
      Jovan Pulitzer surprised us all once again and likely scared the hell out of any election fraudsters in the process. In a video he released Wednesday on Twitter, Jovan explained that identifying markings are in fact on the ballots and are exactly what they were looking for during the audit!
      … a secret printer identifying protocol established years ago by the Secret Service to help catch counterfeiters.
      The matrix decodes the placement of the markings and reveals the precise identity of the printer by serial number along with the exact date and time the document was printed.

  32. Bearhugg says:

    https://mobile.twitter.com/100trillionUSD/status/1430863331309588480?s=19

    Kan Japans intåg med att införa Ivermectin till befolkningen göra världen uppmärksammad på det om det gör succé?

    • peterkrabbe says:

      Ju fler länder som förskriver Ivermectin, desto tydligare kommer resultatet att bli. Problemet vi har är att media kommer att göra allt för att mörklägga sådana nyheter. Vi vet redan att Ivermectin botar, men länder som känner sig förpliktade att följa WHOs rekommendationer kommer inte att ändra sig, detta har med nödgodkännandet av vaccinerna att göra. Godkännandet förutsätter att inga andra mediciner finns, om det kan bevisas att Ivermectin är en sådan medicin skall enligt lagen vaccinerna stoppas tills de kan godkännas enligt gällande och föreskriven procedur, en process som skulle ta många år i anspråk.
      Därför holländarnas desperata böter för läkare som ändå skriver ut Ivermectinet. Allt detta visar att det inte handlar om att rädda livet på människor, utan att skapa förmögenheter genom att kränga ut vaccinsörjan. Ju fler döda, ju större förtjänster.
      Samtidigt förbättrar man samhällsekonomin genom att avliva alla olönsamma individer som pensionärer och multisjuka. Välkommen till den nya världen!

  33. Bdl says:

    Jag har tagit båda sprutorna. Jag har inte haft mer biverkningar än vanligt. Ni här börjar likna en sekt. Min favoritfim är ”Invasion of the bodysnatchers”. Ja och väldigt känslig därmed. Lägg ner.

    • peterkrabbe says:

      Bdl, ingen påstår att alla som tar båda sprutorna får biverkningar eller avlider direkt. Men risken att få det är tillräckligt stor för att analysera och ifrågasätta vaccinerna, som enligt en mångtalig expertis inte är ett traditionellt vaccin utan något helt annat. Detta visas av att fler som nu får Covid är vaccinerade än ovaccinerade. Vaccinet ger inte det skyddet som utlovats, utan utsätter istället den vaccinerade för nya och oförutsägbara risker. Jag har många vänner som tagit sprutorna precis som du och inte visar några oönskade biverkningar – just nu. Däremot finns det tydliga indikationer på att de kan drabbas av stora problem under de kommande åren, det är detta som artikeln handlar om. Därför beklagar jag deras beslut, eftersom det finns andra och bättre sätt att bota Covid om man skulle få viruset.
      Det kan i ditt fall vara så enkelt som att du fått placebo, vi vet inte vem som får detta eftersom de med placebo utgör en kontrollgrupp utan att veta om det. Den forskning som borde utförts INNAN vaccinationerna lanserades görs nu i realtid istället och resultaten får vi i bästa fall veta efteråt. Då är det tyvärr för sent för många.
      Du tycker att vi som föredrar försiktighet och vetenskap är en sekt, men är det inte mer troligt tvärtom, att de som lyder blint utan att ifrågasätta är den verkliga sekten?
      Om man ser på hela konceptet borde det vara övertydligt för alla att det finns en politisk agenda bakom hela detta projekt. Men jag vet att alla orkar inte följa med i debatten och bilda sig en egen uppfattning, då är det enklare att lyda och följa med strömmen. Ske vad som sker. Staten vet bäst. Vi små kryp förstår ändå ingenting.
      Kanske lugnast så för många, men klandra inte oss som istället gör jobbet och ifrågasätter för att minska skadeverkningarna och få bort de värsta skurkarna ur vår tillvaro. Vi lägger inte ner. Men kanske du själv borde tänka efter istället….

Kommentera

Fyll i dina uppgifter nedan eller klicka på en ikon för att logga in:

WordPress.com-logga

Du kommenterar med ditt WordPress.com-konto. Logga ut /  Ändra )

Google-foto

Du kommenterar med ditt Google-konto. Logga ut /  Ändra )

Twitter-bild

Du kommenterar med ditt Twitter-konto. Logga ut /  Ändra )

Facebook-foto

Du kommenterar med ditt Facebook-konto. Logga ut /  Ändra )

Ansluter till %s

%d bloggare gillar detta: